World Families Forums - L96

ARCHIVAL COPY
Home Help Search Login Register
This is an archival copy of the old forum. This copy does not allow new posts, nor can you log in to this forum.
For the current active forum, please visit https://www.worldfamilies.net/forum.

+  World Families Forums
|-+  General Forums - Note: You must Be Logged In to post. Anyone can browse.
| |-+  R1b General (Moderator: Maliclavelli)
| | |-+  L96
« previous next »
Pages: [1] Go Down Print
Author Topic: L96  (Read 1605 times)
Jdean
Old Hand
****
Offline Offline

Posts: 678


L96
« on: March 24, 2009, 01:47:21 PM »


Thomas Krahn has an SNP on his R-M269 tree called L96 below L21, is this new ?
Logged

Y-DNA R-DF49*
MtDNA J1c2e
Kit No. 117897
Ysearch 3BMC9

rms2
Board Moderator
Guru
*****
Offline Offline

Posts: 5023


« Reply #1 on: March 24, 2009, 07:02:22 PM »


Thomas Krahn has an SNP on his R-M269 tree called L96 below L21, is this new ?

That one is new to me.
Logged

vtilroe
Project Coordinator
Old Hand
*****
Offline Offline

Posts: 150


« Reply #2 on: March 24, 2009, 09:09:28 PM »

Looks like Dr. Krahn found another private SNP while analyzing someone's  sequence trace for M222.  L96 is just 42 base-pairs away from the M222 site.

From http://ymap.ftdna.com/

Name:     L96
Type:    snp
Description:    
Source:    other
Position:    ChrY:13411850..13411850 (+ strand)
Length:    1
ISOGG_haplogroup:    not listed
YCC_haplogroup:    not listed
allele_anc:    A
allele_der:    G
comments:    Downstream of R-L21*
primer_f:    GGTGATGGATGAGGAGTAAAAA
primer_r:    CATTCAAGATCCCAGAACTGTC
« Last Edit: March 24, 2009, 09:10:26 PM by vtilroe » Logged

YSearch & MitoSearch: 2GXWW


yDNA: R-U106*


mtDNA: U5a1a1 (Genbank# GQ368895)


R-P312-WTY Project Admin http://tinyurl.com/daertg

Pages: [1] Go Up Print 
« previous next »
Jump to:  


SEO light theme by © Mustang forums. Powered by SMF 1.1.13 | SMF © 2006-2011, Simple Machines LLC

Page created in 0.217 seconds with 18 queries.