Project Home Page

Surname DNA testing is the newest tool available to genealogists. These tests help genealogists verify their paternal ancestry (father's father) in a quick and easy way. It saves time, prevents mistakes, and provides invaluable data that can be obtained in no other way.

Hubertus de la Feld---Feld---Felde---Sir John Field 1400 AD---Feild---FField---Delafield                

                                           Field                                Fields                                                

 All are welcome to view and use the information on these pages.  All those with a Feld, Field or Fields surname or variant are welcome to join this project.  You need to submit your DNA or a male relative's DNA for Ychromosome results to be posted here and join the project.  You decide how much personal information is made available for viewing.  You may remain anonymous if desired.  By working together on this project we have the opportunity to discover many of our ancestors. 

At first viewing note that there is already a benefit.  We are a very old family reaching back into the dark ages.  There are four families listed indicating reproductive cell mutations, possible adoption or other.  Now we can gather members of our haplotype--I--J--R--E and concentrate on locating the ancestors of each.

We hope that you, a Field, Fields or Field/s variant descendant, join and take this journey with us.

__________________________________________________________________________________________________

NEWS

Welcome Jeffrey M Fields, R1b1b2 and H to the Fields Family Project.  He has submitted both Y Results and mtDNA results.  Jeffrey has the same mtDNA haplotype as I do (H).  We know that our mother's, mother's, etc back several thousand years lived in Eastern Europe.   Our results are posted on the mtDNA Page.

• Kim Alan Fields and E. G. Fields are definitely related.  They share a common grandfather within the last 10-18 generations.  ---73.81% in 12 generations and 90% in 16.  There are three differences at locations, CDY-b, 570, 456--all high-lighted in yellow.  Yellow means that these locations mutate more often than others.  We are using probability meaning it could be less than these numbers(10-18).
• More cousins make contact !!!!!!!! Maxwell Smith and Mark E. Field show a close kinship

  over 25 markers.  They are related but not closely.  Five different markers separate them.  They will benefit by comparing pedigrees.   Many on our project share a common grandfather in the last several thousand years.  In this case it is in the last several hundred years so they could benefit by sharing information now and during research.

• Welcome Dr. Shawn Field, F 42,  to our project!!!
• Dr Shawn Field's Y DNA Results has two "new" markers--464e and 464f.  Everyone is checked for these and most of us do not have them.  There are also 464g and 464h which have not appeared in anyone on this Project.
• After 30 years of searching, stuck in South Carolina, finally, we are gathering!!!!!!!!!!
• Dennis Lyn Fields, Michael Eugene Fields, John Thomas Fields, Wells L Field, Harold Arthur Field and Joe L Fields show very similar forms of Y DNA.  All six families are all closely related.  
• Actually we have two groups---Dennis, Michael and John Thomas are in one group
• Joe, Harold and Wells are in a second group
• If you have not done so I would encourage everyone to enter their YDNA results on the Y Search website.  There is a link on your personal page.  Pick Y Search and upload.  You can compare your results with others

THE DNA STORY

This project uses two types of mutations found on the male chromosome.  A third type of mutation from mitochrondia is also used.

The male Y chromosome is passed by a male to his sons.  The male, Y chromosome is used in genetic research because it is tiny, very short and never crosses over with other chromosomes.  Crossing over mixes different families DNA and cannot be followed easily from one generation to the last.  More than 1/2 of our DNA is junk DNA meaning it is not used.  Mistakes and mutations have accumulated in the junk DNA for many, many generations.  One gene that is active but is still junk DNA is a retrovirus.  Some sequences are definitely from bacteria and viruses.  We are quite a mess genetically.  If a mutation occurs in a character gene it is usually detrimental 99 times in 100 so the pedigree ends.  Having ended the history is lost.  However if a mutation occurs in the junk DNA everything (junk DNA and character-other DNA) is copied and passed to the next male again and again and again and again---.  It becomes valuable history for research.  On the Y Results page note that at the top, left of the chart is 393 etc.  The top numbers are loci, locus singular---locations on the Y chromosome---junk DNA.  Below beside each family name is the number of times that a DNA sequence is repeated.  They are called Short Tandem Repeats. At the 393 locus for some members is:

GTGGTCTTCTACTTGTGTCAATACAGAT/AGAT/AGAT/AGAT/AGAT/AGAT/AGAT/AGAT/

ATAG/AGAT/AGAT/AGAT/AGAT/ATGTAT etc for a total of 132 bases.  In this example there are 13 repeats (AGAT) at the 393 location.  In red are the short tandem repeats or strs--AGAT that repeat.  The forward slashes are for ease of counting.  The black bases are bases at this location.  Enzymes move down DNA strands copying each base.  However they don't always count very well--stutter--and copy an extra sequence or leave out a sequence.  The chart on the Y Results page shows the STRs for each families Y Chromosome.

Second mutation--In the above example the sequence starts with a black G.  This base could change--mutate-- to a T, A, C.  The new mutation could be passed on to the next generation.  This type of mutation is called a snip--single nucleotide polymorphism.  Each persons hyplotype is determined by SNIPs.  They occur many times less often than a STR.

A third type of Mutation--occurs in mitochondria, mitochondrion--singular.  This type is known as mtDNA.  Mitochrondia are small cigar shaped organelles that digest our food.  Males and females get their mtDNA from their mother (99.99-%).  So when you analyze your mtDNA you are looking at mitochrondia passed to you from your mother's mother-her mother-her mother back through history.  MtDNA mutations occur less often than STRS.

For those wanting to learn more about DNA try:

Deep Ancestry by Spencer Wells----basic and about tracing the movements of early man

Lords of Battle by Stephen Allen----about the Celts

Saxon, Vikings and Celts by Bryan Sykes---about the distribution of haplotypes in England

Relics of Eden by Daniel Fairbanks---fundamentals of the new genetics

The Seven Daughters of Eve by Bryan Sikes---mtDNA for women and their men

The Journey of Man by Spencer Wells---tracing movements of early man

Genetics by Hartl and Jones---a deep read--college text

Send comments to Jfields007@att.net

• A word for the wise---

 Our patriarch and discussion pages will grow quickly so a word to the wise.  Copy down information that is important to you.  If size becomes a problem for this address, something will have to go.  I will use the following guidelines--Project members are always favored first.

Genealogists will tell all that the best and most correct method to research your family is to go backward from yourself to the next identified generation of your family, then back to the next generation.  This prevents most mistakes.  However if we are cautious and research carefully we can gain some idea where our ancestors may have lived.  In this mode I am publishing as many pedigrees from libraries that I can locate hoping that a connection will lead members to research specific candidates.  I remind myself and others to be careful and gain lots of evidence before making a final decision.  Good Luck!!!!

Everyone should check with your local libraries or even distant libraries.  Many are moving genealogy information onto the internet.  In many cases, for a small fee or simply signing up, you can gain access to the library with an internet address.  You have to ask if they provide this service.  Also a small donation is always appreciated by the library as this service has a cost.

Always be prepared for what you find when you identify your distant relatives.  Some will be Kings others peasants.  One of mine was a hungry, overexposed, tired cherokee woman that stumbled up to a trading post in the Georgia mountains.  The trader took her in and no doubt she became his woman.  Her descendants married a descendant of Alfred 'The Great', King of Wessex, England.  This makes me part proud Native American, as well as a descendant of the Anglo-Saxon Kings of Wessex, Mercia and England.  So in my case the American Melting pot has been stirred thoroughtly and I am equally proud of all of them.

Joe L Fields, Administrator

Jfields007 at att.net

__________________________________________________________________________________________