Project Home Page
Navigate to all pages of the project's website by using the black menu bar above.
Use this link to make a donation to your surname project Sponsorship Fund
Surname DNA testing is the newest tool available to genealogists. These tests help genealogists verify their paternal ancestry (father's father) in a quick and easy way. It saves time, prevents mistakes, and provides invaluable data that can be obtained in no other way.
Knowledge of Human Geneticsi, Research, Patience and determination provides light to brighten the Dark Ages.
Hubertus de la Feld---Feld---Felde---Sir John Field 1400 AD---Feild---FFelde----FField---Delafield
Field Fields
All are welcome to view and use the information on these pages. All those with a Feld, Field or Fields surname or variant are welcome to join this project. You need to submit your DNA or a male relative's DNA for Ychromosome resultsi to be posted here and join the project. You decide how much personal information is made available for viewing. You may remain anonymous if desired. By working together on this project we have the opportunity to discover many of our ancestors.
At first viewing note that there is already a benefit. We are a very old family reaching back into the dark ages. There are four families listed indicating reproductive cell mutations, possible adoption or other. Now we can gather members of our haplotypei--I--J--R--E and concentrate on locating the ancestors of each.
We hope that you, a Field, Fields or Field/s variant descendant, join and take this journey with us.
__________________________________________________________________________________________________
NEWS
Thanks Edward Stanley Field for your contribution to the family site. Note that Edward's data is close to Eugene Allen's. There is a nitrogen base M241 difference. Eugene has tested positive for m241 and Edward's is not known yet.
Sid Field has joined our project. He brings a nice pedigree with him. It reaches back to 1525 and Sir John Field, the Astronomer.
August D Fields has joined our project and matches Randall Frank Fields, Richard Wayne Fields, and Raymond Lewis Fields. Thanks for your contribution August D Fields. August D Fields and Raymond Louis Fields differ by one marker. They are very closely related
Thanks Dr Charles W Field for your contribution to our website. 37 markers, deep clade, and Family Tree Finder.
William Irving Field and William D Tripp are distantly related. 385c and 464c mutate more often than others. The loci at the top of the chart that are shaded yellow mutate more often than the others.
Thanks Kim Alan Fields and Raymond Louis Fields for your contributions to the project. Both are adding more markers.
New Test: Kim Alan Fields has tested positive for the 2c2g marker (464x). This places his ancestor at a location in Ireland and connects him to an ancient Irish clan ---15c 15c 17g 17g!!!!! Congrats Kim!!!
A new pedigree for Joseph Fields has been added to the Patriarch Page. The www.Delderfield.com website information matches this pedigree closely. Welcome Joseph Fields
Attention all R haplotypes--There is a group of R haplotypes with unique markers. Our K A Fields, E G Fields and Jeffrey M Fields show a 14, 13, 30 markers at the number 10, 11, 12 location. you may or may not wish to be tested for the L 159.2 marker. This marker sequence places you in southern Ireland during ancient times. Information can be located at www.familytreedna.com/public/R1b-L159.2/default.aspx or at the email for an administrator--Richard RMStevens2@gm
- Kim Alan Fields and E. G. Fields are definitely related. They share a common grandfather within the last 10-18 generations.
- After 30 years of searching, stuck in South Carolina, finally, we are gathering!!!!!!!!!!
- Sid Field, Dennis Lyn Fields, Michael Eugene Fields, John Thomas Fields, Wells L Field, Harold Arthur Field James Arthur Fields and Joe L Fields show very similar forms of Y DNA. All eight families are closely related.
- Actually we have two groups---Dennis, Michael, James and John Thomas are in one group
- Joe, Harold and Wells are in a second group
- Maxwell Smith and Mark E Fields are distantly related.
- Steven A Griffin and Howell Dowdy are distantly related.
THE DNA STORY
This project uses two types of mutations found on the male chromosome. A third type of mutation from mitochrondia is also used.
The male Y chromosome is passed by a male to his sons. The male, Y chromosome is used in genetic research because it is tiny, very short and never crosses over with other chromosomes. Crossing over mixes different families DNA and cannot be followed easily from one generation to the last. More than 1/2 of our DNA is junk DNA meaning it is not used. Mistakes and mutations have accumulated in the junk DNA for many, many generations. One gene that is active but is still junk DNA is a retrovirus. Some sequences are definitely from bacteria and viruses. We are quite a mess genetically. If a mutation occurs in a character gene it is usually detrimental 99 times in 100 so the pedigree ends. Having ended the history is lost. However if a mutation occurs in the junk DNA everything (junk DNA and character-other DNA) is copied and passed to the next male again and again and again and again---. It becomes valuable history for research. On the Y Results page note that at the top, left of the chart is 393 etc. The top numbers are loci, locus singular---locations on the Y chromosome---junk DNA. Below beside each family name is the number of times that a DNA sequence is repeated. They are called Short Tandem Repeats. At the 393 locus for some members is:
GTGGTCTTCTACTTGTGTCAATACAGAT/AGAT/AGAT/AGAT/AGAT/AGAT/AGAT/AGAT/
ATAG/AGAT/AGAT/AGAT/AGAT/ATGTAT etc for a total of 132 bases. In this example there are 13 repeats (AGAT) at the 393 location. In red are the short tandem repeats or strs--AGAT that repeat. The forward slashes are for ease of counting. The black bases are bases at this location. Enzymes move down DNA strands copying each base. However they don't always count very well--stutter--and copy an extra sequence or leave out a sequence. The chart on the Y Results page shows the STRs for each families Y Chromosomei.
Second mutation--In the above example the sequence starts with a black G. This base could change--mutate-- to a T, A, C. The new mutation could be passed on to the next generation. This type of mutation is called a snip--single nucleotide polymorphism. Each persons hyplotype is determined by SNIPs. They occur many times less often than a STR.
A third type of Mutation--occurs in mitochondria, mitochondrion--singular. This type is known as mtDNAi. Mitochrondia are small cigar shaped organelles that digest our food. Males and females get their mtDNA from their mother (99.99-%). So when you analyze your mtDNA you are looking at mitochrondia passed to you from your mother's mother-her mother-her mother back through history. MtDNA mutations occur less often than STRS.
For those wanting to learn more about DNA try:
Deep Ancestry by Spencer Wells----basic and about tracing the movements of early man
Lords of Battle by Stephen Allen----about the Celts
Saxon, Vikings and Celts by Bryan Sykes---about the distribution of haplotypes in England
Relics of Eden by Daniel Fairbanks---fundamentals of the new genetics
The Seven Daughters of Eve by Bryan Sikes---mtDNA for women and their men
The Journey of Man by Spencer Wells---tracing movements of early man
Genetics by Hartl and Jones---a deep read--college text
Send comments to Jfields007@att.net
- A word for the wise---
Our patriarch and discussion pages will grow quickly so a word to the wise. Copy down information that is important to you. If size becomes a problem for this address, something will have to go. I will use the following guidelines--Project members are always favored first.
Genealogists will tell all that the best and most correct method to research your family is to go backward from yourself to the next identified generation of your family, then back to the next generation. This prevents most mistakes. However if we are cautious and research carefully we can gain some idea where our ancestors may have lived. In this mode I am publishing as many pedigrees from libraries that I can locate hoping that a connection will lead members to research specific candidates. I remind myself and others to be careful and gain lots of evidence before making a final decision. Good Luck!!!!
Everyone should check with your local libraries or even distant libraries. Many are moving genealogy information onto the internet. In many cases, for a small fee or simply signing up, you can gain access to the library with an internet address. You have to ask if they provide this service. Also a small donation is always appreciated by the library as this service has a cost.
Always be prepared for what you find when you identify your distant relatives. Some will be Kings others peasants. One of mine was a hungry, overexposed, tired cherokee woman that stumbled up to a trading post in the Georgia mountains. The trader took her in and no doubt she became his woman. Her descendants married a descendant of Alfred 'The Great', King of Wessex, England. This makes me part proud Native American, as well as a descendant of the Anglo-Saxon Kings of Wessex, Mercia and England. So in my case the American Melting pot has been stirred thoroughtly and I am equally proud of all of them.
Joe L Fields, Administrator
Jfields007 at att.net
__________________________________________________________________________________________
- 7606 reads
Group admins
Project Administrators