World Families Forums - L96

Welcome, Guest. Please login or register.
November 23, 2014, 09:56:41 AM
Home Help Search Login Register

+  World Families Forums
|-+  General Forums - Note: You must Be Logged In to post. Anyone can browse.
| |-+  R1b General (Moderator: rms2)
| | |-+  L96
« previous next »
Pages: [1] Go Down Print
Author Topic: L96  (Read 843 times)
Jdean
Old Hand
****
Offline Offline

Posts: 678


L96
« on: March 24, 2009, 01:47:21 PM »


Thomas Krahn has an SNP on his R-M269 tree called L96 below L21, is this new ?
Logged

Y-DNA R-DF49*
MtDNA J1c2e
Kit No. 117897
Ysearch 3BMC9

rms2
Board Moderator
Guru
*****
Offline Offline

Posts: 5023


« Reply #1 on: March 24, 2009, 07:02:22 PM »


Thomas Krahn has an SNP on his R-M269 tree called L96 below L21, is this new ?

That one is new to me.
Logged

vtilroe
Project Coordinator
Old Hand
*****
Offline Offline

Posts: 150


« Reply #2 on: March 24, 2009, 09:09:28 PM »

Looks like Dr. Krahn found another private SNP while analyzing someone's  sequence trace for M222.  L96 is just 42 base-pairs away from the M222 site.

From http://ymap.ftdna.com/

Name:     L96
Type:    snp
Description:    
Source:    other
Position:    ChrY:13411850..13411850 (+ strand)
Length:    1
ISOGG_haplogroup:    not listed
YCC_haplogroup:    not listed
allele_anc:    A
allele_der:    G
comments:    Downstream of R-L21*
primer_f:    GGTGATGGATGAGGAGTAAAAA
primer_r:    CATTCAAGATCCCAGAACTGTC
« Last Edit: March 24, 2009, 09:10:26 PM by vtilroe » Logged

YSearch & MitoSearch: 2GXWW


yDNA: R-U106*


mtDNA: U5a1a1 (Genbank# GQ368895)


R-P312-WTY Project Admin http://tinyurl.com/daertg

Pages: [1] Go Up Print 
« previous next »
Jump to:  


SEO light theme by © Mustang forums. Powered by SMF 1.1.13 | SMF © 2006-2011, Simple Machines LLC

Page created in 0.076 seconds with 18 queries.