World Families Forums - X-SNP blocks and X-STR single marker

Welcome, Guest. Please login or register.
May 26, 2013, 02:07:21 AM
Home Help Search Login Register

+  World Families Forums
|-+  General Forums - Note: You must Be Logged In to post. Anyone can browse.
| |-+  X-chromosome (X DNA) (Moderator: Seán MacGorman Powell)
| | |-+  X-SNP blocks and X-STR single marker
« previous next »
Pages: [1] Go Down Print
Author Topic: X-SNP blocks and X-STR single marker  (Read 1572 times)
Svaale
Member
**
Offline Offline

Posts: 19


« on: January 23, 2009, 06:56:16 AM »

I think combination of STR and SNP is promising, even just comparing a SNP block with one STR could provide some information.

I did earlier a investigation of the D9S120 marker vis a 400k soround SNP block on Chr 9. The result where interesting as it suggest a strong correlation when it came to the Native American 9 allele and a certain Asian like Native American SNP block.

For example if assuming X-STR mutation rates are faster then two blocks like (here the letters are SNP blocks and the numbers an STR allele):

AAAAA 15 AAAAA
AAAAA 16 AAAAA

And you tested for

AAAAA 15 AAAAA

It would appear as you where more closely related to the first block, making you able to differenciate seemingly identical blocks. Of course more STR blocks is preferable but as this could do for now.
Logged
DKF
Member
**
Offline Offline

Posts: 33


WWW
« Reply #1 on: January 23, 2009, 12:35:39 PM »

I think combination of STR and SNP is promising, even just comparing a SNP block with one STR could provide some information.

I did earlier a investigation of the D9S120 marker vis a 400k soround SNP block on Chr 9. The result where interesting as it suggest a strong correlation when it came to the Native American 9 allele and a certain Asian like Native American SNP block.

For example if assuming X-STR mutation rates are faster then two blocks like (here the letters are SNP blocks and the numbers an STR allele):

AAAAA 15 AAAAA
AAAAA 16 AAAAA

And you tested for

AAAAA 15 AAAAA

It would appear as you where more closely related to the first block, making you able to differenciate seemingly identical blocks. Of course more STR blocks is preferable but as this could do for now.
Svaale:

Yes, I have been thinking along much the same lines.  To get the most out of this work, we will need to combine SNP and STR data within a defined haploblock.

I understand what you are saying about the mutation rate of STRs being in theory higher.  Clearly we understand the relatively high mutation rate on the Y chromosome (such that I match my second to ninth cousins 32-34/37).  However, with respect to the 9A repeat motif on chromosome 9 found in approximately one third of all Native Americans, there does not appear to have been be any mutation here since the original event probably 15,000 or more years ago.  The work of Kari Schroeder (with whom I am in contact) shows that there have been no downward mutations to 8 repeats and only one in her dataset that had mutated upwards to 10.  That is amazing stability and more characteristic of SNPs. 

I have ordered some of the X-STR markers from FTDNA recently - those which I can tie into a journal article.  Many people have submitted their X data to the DNA Fingerprint database of Thomas Krahn (now with FTDNA) and this is available for comparison purposes.  I suspect that Thomas would add other features if interest increased. 

I don't anticipate that the interest in this subject is going to diminish, so considering that the price is quite moderate, and would compliment our 23andme or decodeme data, hopefully the true X-philes among us will test the whole suite of markers available.  I have come this far, might as well go the distance.
Logged

X-chromosome:  56.25% England; 12.5% Scotland; 12.5% Ireland; 12.5% Germany; 6.25% North America (Lower Mohawk, Six Nations)
Svaale
Member
**
Offline Offline

Posts: 19


« Reply #2 on: January 23, 2009, 06:43:56 PM »

I have ordered some of the X-STR markers from FTDNA recently - those which I can tie into a journal article.  Many people have submitted their X data to the DNA Fingerprint database of Thomas Krahn (now with FTDNA) and this is available for comparison purposes.  I suspect that Thomas would add other features if interest increased. 

The problem with Fingerprints database is that it will become obsolete long before the numbers of entries become anything close to representative, I prefer to involve myself with markers where it is possible to compare yourself with a world-wide database available now, having markers there is only scattered data about is total waste of money.

Database first -> then test, not test first - > Database (maybe) later.
Logged
geneticgenie
Member
**
Offline Offline

Posts: 45


« Reply #3 on: January 26, 2009, 07:46:07 PM »

I have ordered some of the X-STR markers from FTDNA recently - those which I can tie into a journal article.  Many people have submitted their X data to the DNA Fingerprint database of Thomas Krahn (now with FTDNA) and this is available for comparison purposes.  I suspect that Thomas would add other features if interest increased. 

The problem with Fingerprints database is that it will become obsolete long before the numbers of entries become anything close to representative, I prefer to involve myself with markers where it is possible to compare yourself with a world-wide database available now, having markers there is only scattered data about is total waste of money.

Database first -> then test, not test first - > Database (maybe) later.

Maybe I am more optimistic or curious but there are STR results that I would like to see already in relation to our SNP blocks that are offered by FTDNA. For example, have you looked at the bimodal distribution of marker DXS10074 at DNA Fingerprint and wondered what caused it?

There are numerous people with 7 repeats from the Ukraine.  Some (most?) are Ashkenazim.

So my question is what do their SNP blocks look like and do these differ from the majority of people who have 13 through 20 at DXS10074?  I don’t see anyone with 9 or 10 or 11 or 12 although I see some with 8.  The closest intergenic SNP that is tested at 23andMe would be rs1931545.

I know that I have nearly matching parents here (in the same block as the STR) in which the SNPs are typically found in Africa but almost never in Asia. So what do their STRs look like?  My STR results are pending so I can’t answer that yet. But here are my 24 SNP results from position 66895296 ( rs1931545) through 67171306 (rs1576059) for anybody wanting to share SNPs plus STR DXS10074.
GCG*GCCCAAGGCTATATGCCTGA (* is heterozygous CT)

I have deliberately left out the genes AR and OPHN1. My haplotype should be the minority found in Western Europe.  We need also to see what the majority of Western Europeans look like and any other blocks that could show up in Eastern Europe that might be associated with the repeats of 7. Then we should look at Asians and Africans or other associations that are of interest.

So I think it is worth jump starting this investigation unless you can think of a very good
reason not to do so? Privacy was more of a concern to me than cost.  Women spend more
money on their hair  month than on the cost of these STRs.
Kathy J.


Logged

Kathy J.
X Chromosomes: 75% English, 12.5% German, 6.25% Dutch, 3.125% Irish, 3.125% Scottish;
from Father's X: 43.75% English, 6.25% Dutch;
from Mother's X: 31.25% English, 12.5% German, 3.125% Irish, 3.125% Scottish
Svaale
Member
**
Offline Offline

Posts: 19


« Reply #4 on: January 27, 2009, 09:04:45 AM »

So I think it is worth jump starting this investigation unless you can think of a very good
reason not to do so? Privacy was more of a concern to me than cost.  Women spend more
money on their hair  month than on the cost of these STRs.
Kathy J.

I recently found a 36 x-str linked loci dataset using HGDP panel that could be interesting to investigate together with the x-snp HGDP panel. However only 1 marker in this set is offered by FTDNA and the allele standard used is different so any personal use is out of the question for the moment, but still useful to test.
Logged
DKF
Member
**
Offline Offline

Posts: 33


WWW
« Reply #5 on: January 27, 2009, 12:36:44 PM »

Quote
Maybe I am more optimistic or curious but there are STR results that I would like to see already in relation to our SNP blocks that are offered by FTDNA. For example, have you looked at the bimodal distribution of marker DXS10074 at DNA Fingerprint and wondered what caused it?
There would appear to be a lot to learn in relation to the "connection" between STRs and SNPs.  In an analysis that Anders did on my behalf with PLINK he found that I had a 2 Mb exact match with a Yakut on chromosome 9.  The STR DS91120 (to confuse things another name is used by FTDNA) is located in the middle of this block.  It is interesting that Anders was able to locate the STR value of my Yakut match and it was 17-17, whereas I have a very rare motif of 18-19.  The Yakut are among the very few groups to have a repeat value of 19 at this location (the highest percentage are the Naxi in East Asia and Sioux in North America with over 10% having this allele).  So, assuming that this applies to the X, having an identical SNP block match does not necessarily mean that the STRs will be the same.  I would assume that proximity of relationship is a factor so that those sharing a common ancestry within that past few hundred years should be equivalent on both, but extending back thousands of years such as the Yakut and myself there are many "rearrangements" that could ensure that some STRs in a haploblock will match, and some that will not.

I guess that rather than testing other family members with decodeme or 23andme at this point, getting the full set of FTDNA X STRs would be a smarter choice; and here is a novel thought, encourage family members to pay for their own testing.
Logged

X-chromosome:  56.25% England; 12.5% Scotland; 12.5% Ireland; 12.5% Germany; 6.25% North America (Lower Mohawk, Six Nations)
Maria_W
Member
**
Offline Offline

Posts: 10


« Reply #6 on: January 31, 2009, 02:33:12 AM »

DKF,

How did you figure out your ethnic percentages in your signature tag? I would love to do that!  I have Potowomeke, Irish, English, Scottish, Welsh, French, Swiss and German that I know of. 

Maria
Logged

DeCodeMe: Autosomal: African 2%, Asian 6%,  European 92%.  X: African 4%, Asian 9%, European 87%.
23andme: pending.
United States (Native American: Potowomecke from Virginia and European(Ireland, Scotland, Wales, England, Germany, Switzerland and France)
geneticgenie
Member
**
Offline Offline

Posts: 45


« Reply #7 on: February 01, 2009, 02:15:00 PM »

DKF,

How did you figure out your ethnic percentages in your signature tag? I would love to do that!  I have Potowomeke, Irish, English, Scottish, Welsh, French, Swiss and German that I know of. 

Maria

I used Jim Turner's pedigree inheritance chart for women, two pages and filled in the ethnic origins of each person:

http://freepages.genealogy.rootsweb.ancestry.com/~hulseberg/DNA/xinheritance.html

It helps to print out your ancestry pedigree from your family tree to fill in the blanks.

When you know the ethnic origin for the most distant relative, circle the percentage.
When you add up the percentages, the most distant X ancestors should add up to 100%.
I know many more ancestors than are listed in these charts, but most of the time I could stop at an ancestor if their ethnic origins were all 100% one ethnic group, English being the most common Colonial group. Actually English turns out to be more than I thought. My mitochondrial line, Scottish only adds up to 3.125% so that goes to show you how little the all-female line can add to your X ethnicity. My father's Y was also Scottish but adds nothing. The Dutch is amplified because of the zig-zag effect of male alternating with female.

So I came up with
Ancestor 42 makes me 12.5% English (to add to the English below)
Ancestor 43 is half Dutch and half English so that makes it 6.25% each.
Ancestor 13 is all English so that adds 25%
Ancestor 14 is 12.5% of my X makeup and he was full blooded German
Ancestor 30 makes me 6.25% English
Ancestor 62 makes me 3.125% Irish
Ancestor 63 makes me 3.125% Scottish
Ancestor 11 makes me 25% English from that line

So add these all up and I get
75% English
12.5% German
6.25% Dutch
3.125% Irish
3.125% Scottish

This is the closest estimate I can make at the present time.  I suspect there could
be some surprises in the future.
Kathy J.
Logged

Kathy J.
X Chromosomes: 75% English, 12.5% German, 6.25% Dutch, 3.125% Irish, 3.125% Scottish;
from Father's X: 43.75% English, 6.25% Dutch;
from Mother's X: 31.25% English, 12.5% German, 3.125% Irish, 3.125% Scottish
Maria_W
Member
**
Offline Offline

Posts: 10


« Reply #8 on: February 03, 2009, 12:18:38 AM »

Kathy,

Thank you very much for your reply.  That is so amazing and cool!!! Well I know it will be North American (Native American:Potowomecke) and European, thats for sure!

Maria
Logged

DeCodeMe: Autosomal: African 2%, Asian 6%,  European 92%.  X: African 4%, Asian 9%, European 87%.
23andme: pending.
United States (Native American: Potowomecke from Virginia and European(Ireland, Scotland, Wales, England, Germany, Switzerland and France)
Seán MacGorman Powell
X-chromosome Project Administrator
Board Moderator
Old Hand
*****
Offline Offline

Posts: 152



WWW
« Reply #9 on: February 20, 2009, 11:21:22 AM »

I've just added my X-STR results (MacGorman) for DXS10079, 10074, and 10075, to the X-SNP haploblock candidates results chart:

http://www.worldfamilies.net/geo/xdna/results/raw

I'll post my remaining STRs to the other (X-STR) results chart when they come in.
Logged

a.k.a., GhostX
tomcat
Member
**
Offline Offline

Posts: 20


« Reply #10 on: February 20, 2009, 02:03:14 PM »

Although this is off-topic for X it is relevant to the analysis of SNP's and STR's and linkage disequilibrium.This is a For Sale article.

Mol Biol Evol. 2009 Feb 17. [Epub ahead of print]

Haplotypic background of a private allele at high frequency in the Americas.

Schroeder KB, Jakobsson M, Crawford MH, Schurr TG, Boca SM, Conrad DF, Tito
RY, Osipova LP, Tarskaia LA, Zhadanov SI, Wall JD, Pritchard JK, Malhi RS,
Smith DG, Rosenberg NA.

Department of Anthropology, University of California, Davis, Davis,
California, United States of America.

Recently, the observation of a high-frequency private allele, the 9-repeat
allele at microsatellite D9S1120, in all sampled Native American and Western
Beringian populations has been interpreted as evidence that all modern Native
Americans descend primarily from a single founding population. However, this
inference assumed that all copies of the 9-repeat allele were identical by descent
and that the geographic distribution of this allele had not been influenced
by natural selection. To investigate whether these assumptions are satisfied,
we genotyped 34 SNPs across approximately 500 kilobases (kb) around D9S1120 in
21 Native American and Western Beringian populations and 54 other worldwide
populations. All chromosomes with the 9-repeat allele share the same haplotypic
background in the vicinity of D9S1120, suggesting that all sampled copies of
the 9-repeat allele are identical by descent. Ninety-one percent of these
chromosomes share the same 76.26 kb haplotype, which we call the "American Modal
Haplotype" (AMH). Three observations lead us to conclude that the high
frequency and widespread distribution of the 9-repeat allele are unlikely to be the
result of positive selection: 1) aside from its association with the 9-repeat
allele, the AMH does not have a high frequency in the Americas, 2) the AMH is
not unusually long for its frequency compared to other haplotypes in the
Americas, and 3) in Latin American mestizo populations, the proportion of Native
American ancestry at D9S1120 is not unusual compared to that observed at other
genomewide microsatellites. Using a new method for estimating the time to the
most recent common ancestor (MRCA) of all sampled copies of an allele on the
basis of an estimate of the length of the genealogy descended from the MRCA, we
calculate the mean time to the MRCA of the 9-repeat allele to be between 7,325
and 39,900 years, depending on the demographic model used. The results support
the hypothesis that all modern Native Americans and Western Beringians trace a
large portion of their ancestry to a single founding population which may
have been isolated from other Asian populations prior to expanding into the
Americas.

PMID: 19221006 [PubMed - as supplied by publisher]
Logged

Paternal X: 100% Ukrainian Ashkenazi. Maternal X: 50% Upper Midwest Native American, 50% European.
Pages: [1] Go Up Print 
« previous next »
Jump to:  


SEO light theme by © Mustang forums. Powered by SMF 1.1.13 | SMF © 2006-2011, Simple Machines LLC

Page created in 0.153 seconds with 19 queries.