World Families Forums - How to use the UCSC Genome Browser for the X chromosome

Welcome, Guest. Please login or register.
May 21, 2013, 08:25:45 PM
Home Help Search Login Register

+  World Families Forums
|-+  General Forums - Note: You must Be Logged In to post. Anyone can browse.
| |-+  X-chromosome (X DNA) (Moderator: Seán MacGorman Powell)
| | |-+  How to use the UCSC Genome Browser for the X chromosome
« previous next »
Pages: [1] Go Down Print
Author Topic: How to use the UCSC Genome Browser for the X chromosome  (Read 992 times)
geneticgenie
Member
**
Offline Offline

Posts: 45


« on: January 24, 2009, 02:51:17 PM »

How to use the UCSC Genome Browser for the X chromosome:

At some point, genealogists are going to want to find a conserved block of DNA where cross-over recombination rarely occurs, then try to separate out more recent mutations that should occur in variable regions between unique event polymorphisms.
 
Thomas Krahn of FTDNA suggested using this browser to determine the location of
single nucleotide polymorphisms (SNPs) and the short tandem repeats (STRs) with dbSNP Build 129.

For example, I wanted to know where on the X chromosome the STR (tested by FTDNA) DXS10074 was located in relation to genes and various SNPs.

This journal article by Hering et al
http://www.excli.de/vol6/Hering06-07proof.pdf
gave one of the nearby SNP as  rs5918767 but I still wanted to know the exact location in relation to the STRs.

You can go to http://genome.ucsc.edu but in order to actually find the location
you will need the forward and reverse primers given in the paper above.   

Click on Genome Browser.
You can try clicking on PCR and paste the forward primer then the reverse primer but that is not currently successful because the browser has not been recently updated.  Alternatively you can go to BLAT to paste the forward and reverse primers into the field.

TAGGCGCTTCCTAGACCTCA  TGAGAACATGGGAAGGAAGG or
TAGGCGCTTCCTAGACCTCA nTGAGAACATGGGAAGGAAGG  also works

Click on Browser which takes you to the Genome Browser again

chrX:66,893,724-66,894,224
will show up in the window “position/search”

Use drop-down controls to hide or show information. Under “Variations and Repeats” make sure SNPs (129), RepeatMasker and Simple Repeats are not hidden. Hit Refresh.

To expand the information, click on the SNPs and Simple Repeats to the left of the Browser data.

To see more information, click on Configure under the data, toggle the features you want then click on Submit.

If you want to see genes, you will have to expand the area surrounding this SNP, for example,
chrX:65,000,000-68,000,000

Kathy J.
Logged

Kathy J.
X Chromosomes: 75% English, 12.5% German, 6.25% Dutch, 3.125% Irish, 3.125% Scottish;
from Father's X: 43.75% English, 6.25% Dutch;
from Mother's X: 31.25% English, 12.5% German, 3.125% Irish, 3.125% Scottish
Seán MacGorman Powell
X-chromosome Project Administrator
Board Moderator
Old Hand
*****
Offline Offline

Posts: 152



WWW
« Reply #1 on: January 24, 2009, 07:53:27 PM »

Thanks very much for posting that info, Kathy, that is very helpful.

I thought Thomas had already posted the chromosome positions of the markers that are tested at FTDNA.  If you go to the Xmatch search engine and look underneath the data entry boxes for each marker, you'll see a number that looks just like a position number to me:

http://www.dna-fingerprint.com/modules.php?op=modload&name=xmatch

However, the number that he provides for DXS10074 is 120,700,000 (near the bottom of the X chromosome), whereas the position that's mentioned in the paper you referenced is in the 66 million region.

I must be missing something here.  Any idea what these numbers are?
Logged

a.k.a., GhostX
geneticgenie
Member
**
Offline Offline

Posts: 45


« Reply #2 on: January 25, 2009, 03:14:22 PM »

Thanks very much for posting that info, Kathy, that is very helpful.

I thought Thomas had already posted the chromosome positions of the markers that are tested at FTDNA.  If you go to the Xmatch search engine and look underneath the data entry boxes for each marker, you'll see a number that looks just like a position number to me:

http://www.dna-fingerprint.com/modules.php?op=modload&name=xmatch

However, the number that he provides for DXS10074 is 120,700,000 (near the bottom of the X chromosome), whereas the position that's mentioned in the paper you referenced is in the 66 million region.

I must be missing something here.  Any idea what these numbers are?
That will have to be a Thomas Krahn question.  Those numbers misled me completely.
We are going to need to convert these numbers to those positions associated with the SNP locations.
Logged

Kathy J.
X Chromosomes: 75% English, 12.5% German, 6.25% Dutch, 3.125% Irish, 3.125% Scottish;
from Father's X: 43.75% English, 6.25% Dutch;
from Mother's X: 31.25% English, 12.5% German, 3.125% Irish, 3.125% Scottish
Pages: [1] Go Up Print 
« previous next »
Jump to:  


SEO light theme by © Mustang forums. Powered by SMF 1.1.13 | SMF © 2006-2011, Simple Machines LLC

Page created in 0.111 seconds with 18 queries.