World Families Forums - Another proof for my theory of the Italian Refugium?

Welcome, Guest. Please login or register.
May 23, 2013, 07:15:18 AM
Home Help Search Login Register

+  World Families Forums
|-+  General Forums - Note: You must Be Logged In to post. Anyone can browse.
| |-+  R1b and Subclades (Moderator: rms2)
| | |-+  Another proof for my theory of the Italian Refugium?
« previous next »
Pages: [1] Go Down Print
Author Topic: Another proof for my theory of the Italian Refugium?  (Read 407 times)
Maliclavelli
Guru
*****
Online Online

Posts: 1949


« on: December 30, 2012, 12:12:40 PM »

John Walden has written some interesting posts on Rootsweb. This is the question:
1)   By Geno 2.0 he got the mutation  CTS6519.
“That data is just what I need to check on my CTS6519 mutation T-> C
chromosome:GRCh37:Y:16962502:16962524:1
Ancestral is 1 AGCAGTTGTCCTGAATTAATCGG
|WALDEN 1 AGCAGTTGTCCCGAATTAATCGG
Y-Position NCBI36 15471907
Y-Position GRCh37 16962513
Is there a way I can get access to the data to see if I can find a
connection to CTS6519?”
2)   Greg Magoon wrote: “Hi John,
This mutation (b37 16962513 T->C) is found in a P312+ sample from Tuscany,
Italy (population code TSI) with the name NA20770”.
a) Reynolds replied: “John,
How do you know that you are P312-? I looked at the your Walden
subgroup in the Walden project at FTDNA and did not see any P312
tests”.
b) Also Ann  Turner intervened: “John, do you have results from 23andMe for rs34276300? A is the derived value”.
c) Walden: “Yes my 23andMe data shows rs34276300 Y 22157311 A
Which is P312 + so that means there are two known men with P312+ and
CTS6519+. One is Italian and one is American of oral history from Scotland
Right? Does that make this a candidate for a Subclad of P312?
Given what FTDNA/Geno 2.0 reports about me, that is I am P310, I conclude
they have not tested P312”.
d) Greg Magoon gave the haplotree: “I would classify NA20770 as DF27+ (more specifically, Z2564-Z2567+, which should be downstream of DF83 and others, which, in turn should be downstream from DF27:
https://docs.google.com/spreadsheet/ccc?key=0Agq_ez43qXCjdFlxemtlUnZ1Qk01cVhMRVBFcm5WX3c&authkey=CIOag_UD&authkey=CIOag_UD#gid=27).
This mutation (b37 16962513 T->C) appears to be downstream from Z2562-Z2563
and is likely either phyloequivalent with Z2564-Z2567 or downstream of
them. (The other Z2564-Z2567+ sample, HG00739, has a 'no-call' here.)”
3)   I give the ancestral origin: Tuscany (Italy).

« Last Edit: December 30, 2012, 12:21:53 PM by Maliclavelli » Logged

Maliclavelli


YDNA: R-Z2105+ L277- L584-


MtDNA: K1a1b1e

Maliclavelli
Guru
*****
Online Online

Posts: 1949


« Reply #1 on: December 31, 2012, 04:57:49 AM »

I invite you all to compare this Brazilian (Somensati), who descends probably from the Venetian family Semenzato (ySearch ID: 7CUUC), tested by SMGF, with these guys from the Isles and it would be interesting to test them for CTS6519. I’ll contact Somensati through Facebook.

EPQQ4
Haplogroup:   R1b1a2a1a1b (tested)
Last name:   Ham
Variant spellings:   Kid Kidde Kyd(de) Ked(d)         
   Kide Keed(e) Kead(e) Keid         
Tested with:   Family Tree DNA
Contact person:   Derek Ham     Contact this user

Most distant known paternal ancestor on the direct male line
First Name:   Henry
Last Name:   Kyd
Year Born:   1595
Year Died:   
Country of Origin:   Monifieth, Angus, Scotland
Latitude:   56 deg 29 min N
Longitude:   2 deg 49 min W

Additional information about Paternal Line:
Y-DNA matches generally suggest Northumbria origin more than 57 generations ago. Other surname variants are: Kede, Kide (Scottish dialect in Roxburghshire area). The origin of this surname group is probably from the conversion of Britons (Romano-Celtic, Anglo-Saxon) to Christianity; Bishop Cedd, was a missionary of Celtic Christianity ~634-664 AD (trained under Aidan on Lindisfarne). There are several place names linked to Cedd (Kedington,Keddington, Kiddington,Cuddington,Kidderminster) derived from communities converted by St Cedd in Northumbria, Mercia, East Anglia and Essex. 'Baptised' families would have adopted baptismal surnames such as Kidd/Kydd/Kidda(er)/Keddie(y), which derive from Cydd/Cedd(e) - OE rarely used the letter K but was common in Latin, and the county Cent was pronounced 'Kent' (hence Cedd>Kedd) rather than 'Sent' or 'Chent', ; Romanised Britons adopting a Nomen Gentile/Cognomen, in convention of their Roman predecessors. WTY revealed no new SNP

JCEA9
Haplogroup:   Unknown
Last name:   Walden
Variant spellings:   Waldon Waldron Waldin Waldren         
   Walling Wallen Kidd          
Tested with:   Family Tree DNA
Contact person:   John Walden     Contact this user

Most distant known paternal ancestor on the direct male line
First Name:   (orphan) John
Last Name:   Walden
Year Born:   1756
Year Died:   1835
Country of Origin:   Middlesex County, Virginia, USA
Latitude:   37 deg 38 min N
Longitude:   76 deg 33 min W


Additional information about Paternal Line:
Orphaned as a infant, probably adopted by his mother's(?) Walden family. Son Richard Matches KIDD family of the same county. The Kidd family is probably from Scotland SNP tested P312 (aka S116+, rs34276300 (ve+) )
« Last Edit: December 31, 2012, 04:58:49 AM by Maliclavelli » Logged

Maliclavelli


YDNA: R-Z2105+ L277- L584-


MtDNA: K1a1b1e

Pages: [1] Go Up Print 
« previous next »
Jump to:  


SEO light theme by © Mustang forums. Powered by SMF 1.1.13 | SMF © 2006-2011, Simple Machines LLC

Page created in 0.133 seconds with 17 queries.