mutation numbers - up or down?

[Schwarzburg-Sondershausen]

This is probably a really dumb question but when looking at Y-DNA markers, do the numbers that are higher mean they have mutated more than the lower numbers? So when comparing one's Y-DNA with someone elses can you tell which person's Y-DNA had mutated more by the numeric value of the marker? Can marker numbers mutate downward in value? And what does "null" mean in this context?

[thetick]

Ydna markers are STRs (Short Tandem Repeats).  So for example at location say 522 there is GATTAGATTAGATTAGATTAGATTA  would be shown as DYS522=5.  So a number lower means the sequence was cut off when copied and a higher number means an extra number of the sequence was copied.  Note: none of the DNA companies report partial sequences.

[Schwarzburg-Sondershausen]

Ydna markers are STRs (Short Tandem Repeats).  So for example at location say 522 there is GATTAGATTAGATTAGATTAGATTA  would be shown as DYS522=5.  So a number lower means the sequence was cut off when copied and a higher number means an extra number of the sequence was copied.  Note: none of the DNA companies report partial sequences.

That is something I didn't understand...thank you for explaining. Am I right in understanding that the mutation can go both ways...that the sequence could be copied with only four repeats instead of five or vice-versa so one can never tell which one is the original?
 

[thetick]

In general you are correct.  But one can sometimes make educated guesses on mutations.  For example I have a 7th cousin with a common ancestor born in 1700.  We match 66/67 markers.  The marker we differ is most likely on my cousin's side.  All my closest matches and almost everyone in my subclade has the same vale for that marker as I.  

I'm certainly not sure but it is much more likely the DNA only mutated once instead of twice, or four times etc.  To know for sure you would need more cousin's tested.

And to answer your question about 'Null' it just means there was no detectable DNA sequence at that location.  This can happen due to faulty equipment, or can be a real mutation that lost the sequence.  In the case of those with a 'null'  the DNA company tested the location multiple times before determining a 'null' status.

[Terry Barton]

All of the discussions I have seen advise that it's about as likely to have a mutation be a higher count as a lower count.  And. I really like the expression "A mutation is a mutation is a mutation" (which basically means don't weigh one mutation more heavily than another for an individual comparison)

Typically, mutations are a single step, with the exceptions being mostly at multi-markers.

There are a scattered number of instances where it is clear that other markers have changed by 2 or more in a single step.  (This can cause you not to find your matches if you have a single mutation of 4 steps plus any other mutation in the first 37 markers)